
Baculovirus Transfer Vector Plasmid Compatibility
Published on July 3, 2018A frequent customer query concerns baculovirus transfer vector plasmid compatibility with either flashBACTM or other systems for making recombinant viruses. Obviously, if you are buying flashBACTM and our pOET range of transfer vectors you won’t have a problem. However, given that baculovirus expression vectors have been around since 1983 and many labs have produced variations around a theme, it is not surprising that confusion can arise.
Most baculovirus expression vectors are made using either homologous recombination in insect cells or via transposition insertion in bacteria. Therefore, your major decision is which of these systems applies. There is a limited range of plasmid transfer vector used for the latter system but many more for homologous recombination in insect cells. Plasmid names can be very confusing as many are based on the name(s) of the original scientist(s) who made them and follow no particular convention.
To help you out we have published a list of transfer vectors and their compatibility on the OET website. Despite this resource, every so often someone asks us about a vector that isn’t on the list. We are very happy to decipher the compatibility of your plasmid and provide a speedy response. However, outside of normal working hours the inevitable delay may frustrate.
Therefore, providing you are familiar with sequence comparison programmes such as BLAST and have the DNA sequence of your plasmid, you can use the following information to match it with other transfer vectors. To explain this we use the pOET1 transfer vector.
Below, we present a simple diagram of the regions upstream and downstream of the polyhedrin gene promoter.
Here is the sequence of the region 1-1300
aggccgtgacgttaaaactattaagccatccaatcgaccgttagtcgaatcaggaccgctggtgcgagaagccgcgaagtatggcgaatgcatcgtataacgtgtggagt
ccgctcattagagcgtcatgtttagacaagaaagctacatatttaattgatcccgatgattttattgataaattgaccctaactccatacacggtattctacaatggcggggtt
ttggtcaaaatttccggactgcgattgtacatgctgttaacggctccgcccactattaatgaaattaaaaattccaattttaaaaaacgcagcaagagaaacatttgtatgaa
agaatgcgtagaaggaaagaaaaatgtcgtggacatgctgaacaacaagattaatatgcctccgtgtataaaaaaaatattgaacgatttgaaagaaaacaatgtaccg
cgcggcggtatgtacaggaagaggtttatactaaactgttacattgcaaacgtggtttcgtgtgccaagtgtgaaaaccgatgtttaatcaaggctctgacgcatttctacaa
ccacgactccaagtgtgtgggtgaagtcatgcatcttttaatcaaatcccaagatgtgtataaaccaccaaactgccaaaaaatgaaaactgtggacaagctctgtccgttt
gctggcaactgcaagggtctcaatcctatttgtaattattgaataataaaacaattataaatgctaaatttgttttttattaacgatacaaaccaaacgcaacaagaacatttg
tagtattatctataattgaaaacgcgtagttataatcgctgaggtaatatttaaaatcattttcaaatgattcacagttaatttgcgacaatataattttattttcacataaacta
gacgccttgtcgtcttcttcttcgtattccttctctttttcatttttctcctcataaaaattaacatagttattatcgtatccatatatgtatctatcgtatagagtaaattttttgttgt
cataaatatatatgtcttttttaatggggtgtatagtaccgctgcgcatagtttttctgtaatttacaacagtgctattttctggtagttcttcggagtgtgttgctttaattattaa
atttatataatcaatgaatttgggatcgtcggttttgtacaatatgttgccggcatagtacgcagcttcttctagttcaattacaccattttttagcagcaccggattaacataa
ctttccaaaatgttgtacgaaccgttaaacaaaaacagttcacctcccttttctatactattgtctgcgagcagttgtttgttgttaaaaataacagccat
Here is the sequence 1628-2160
attaagcgctagattctgtgcgttgttgatttacagacaattgttgtacgtattttaataattcattaaatttataatctttagggtggtatgttagagcgaaaatcaaatgatttt
cagcgtctttatatctgaatttaaatattaaatcctcaatagatttgtaaaataggtttcgattagtttcaaacaagggttgtttttccgaaccgatggctggactatctaatgga
ttttcgctcaacgccacaaaacttgccaaatcttgtagcagcaatctagctttgtcgatattcgtttgtgttttgttttgtaataaaggttcgacgtcgttcaaaatattatgcgct
tttgtatttctttcatcactgtcgttagtgtacaattgactcgacgtaaacacgttaaataacgcttggacatatttaacatcgggcgtgttagctttattaggccgattatcgtc
gtcgtcccaaccctcgtcgttagaagttgcttccgaagacgattttgccatagccacacgacgccta
If you match both these two sequences with your own transfer vector you can quickly see if it is compatible for recombinant baculovirus generation in insect cells and in particular, if it will work with flashBACTM DNA.
Should you still remain unsure about the suitability of your transfer vector please contact us at info@oetltd.com and we will be able to provide further information.